pODN-mNG-RHOA
(Plasmid #183836)

• Purpose: Repair template for the N-terminal tagging of RhoA with mNeonGreen in human cells using CRISPR/Cas9.
• Depositing Lab: Alisa Piekny
• Publication: Husser et al Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23.

Backbone

• Vector backbone: pJET1.2
• Backbone manufacturer: Thermo Fischer Scientific
• Backbone size w/o insert (bp): 2974
• Total vector size (bp): 5800
• Vector type: Mammalian Expression, CRISPR ; Donor template

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RHOA homology arms with mNeonGreen-linker
• Alt name: Ras homolog family member A
• Species: H. sapiens (human)
• Insert Size (bp): 2826
• Mutation: Homology arms contain point mutations to remove the sgRNA target site
• GenBank ID:
• Entrez Gene: RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
• Tag / Fusion Protein:
  • mNeonGreen-linker (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CAACTGCTTTAACACTTGTGCCTG
• 3′ sequencing primer: GTTCCTGATGAGGTGGTTAGCATAG

Resource Information

• Supplemental Documents:
  • pODN-mNG-RHOA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry