Skip to main content
Addgene

pLenti CMV/TO GFP-Zeo DEST (719-1)
(Plasmid #17431)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17431 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 17431-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105

Backbone

  • Vector backbone
    p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
  • Backbone size (bp) 10140
  • Vector type
    Mammalian Expression, Lentiviral ; Destination vector
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    DB3.1 or ccDB survival, 37oC
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cggctcgtataatgtgtgga
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are several sequence discrepancies between Addgene's sequence and depositor's sequence. These mismatches are in backbone regions and should not affect function.

Information for Cloning Grade DNA (Catalog # 17431-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV/TO GFP-Zeo DEST (719-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17431 ; http://n2t.net/addgene:17431 ; RRID:Addgene_17431)
  • For your References section:

    A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394