gCH29 (crCD81-1)
(Plasmid
#217344)
-
PurposecrRNA targeting CD81
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRG212
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrCD81-1
-
gRNA/shRNA sequenceggcgcgacccccaggaaggtctc
-
SpeciesH. sapiens (human)
-
Entrez GeneCD81 (a.k.a. CVID6, S5.7, TAPA1, TSPAN28)
- Promoter hU6
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gCH29 (crCD81-1) was a gift from Luke Gilbert (Addgene plasmid # 217344 ; http://n2t.net/addgene:217344 ; RRID:Addgene_217344) -
For your References section:
Engineered CRISPR-Cas12a for higher-order combinatorial chromatin perturbations. Hsiung CC, Wilson CM, Sambold NA, Dai R, Chen Q, Teyssier N, Misiukiewicz S, Arab A, O'Loughlin T, Cofsky JC, Shi J, Gilbert LA. Nat Biotechnol. 2024 May 17. doi: 10.1038/s41587-024-02224-0. 10.1038/s41587-024-02224-0 PubMed 38760567