pAcBac1-BacMam-4x-PyOtR
(Plasmid
#217364)
-
PurposeExpresses four copies pyrrolysyl tRNA variant "PyOtR" with U6 promoter; can be packaged in bacmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAcBac1
-
Backbone manufacturerderived from pFastBac-Dual from Invitrogen.
- Backbone size w/o insert (bp) 8024
- Total vector size (bp) 9411
-
Vector typeMammalian Expression, Insect Expression ; baculoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Gentamicin, 100 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name4 copies of pyrrolysyl-tRNA mutant PyOtR
-
Alt name4xU6-PytOR
-
Alt name4xPytOR
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)1387
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site AvrII (destroyed during cloning)
- 5′ sequencing primer CCAATAGGCCGAAATCGGCAAAATCC
- 3′ sequencing primer GCAGCTTATAATGGTTACAAATAAAGCAATAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcBac1-BacMam-4x-PyOtR was a gift from Abhishek Chatterjee (Addgene plasmid # 217364 ; http://n2t.net/addgene:217364 ; RRID:Addgene_217364) -
For your References section:
Enhanced Directed Evolution in Mammalian Cells Yields a Hyperefficient Pyrrolysyl tRNA for Noncanonical Amino Acid Mutagenesis. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Malley K, Pham Q, Loynd C, Huang Z, van Opijnen T, Chatterjee A. Angew Chem Int Ed Engl. 2024 Jan 26:e202316428. doi: 10.1002/anie.202316428. 10.1002/anie.202316428 PubMed 38279536