pOET5 rota-VLP
(Plasmid
#218147)
-
PurposeForms rotavirus-like particles in insect cells by expression of VP6 (GenBank ID: ACL93331.1).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepOET5.1
-
Backbone manufacturerOxford Expression Technologies
- Backbone size w/o insert (bp) 4581
- Total vector size (bp) 5775
-
Modifications to backboneP10 promoter replaced with CMV enhancer and promoter
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRotavirus VP6
-
Alt nameRotavirus capsid protein VP6
-
Alt nameVP6
-
SpeciesH. sapiens (human); Human rotavirus
-
Insert Size (bp)1194
-
GenBank IDACL93331.1
- Promoter Polyhedrin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CTGTTACGAAAACAGTAAAATACTT
- 3′ sequencing primer TAAATCAACAACGCACAGAATCTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGene synthetically produced and cloned by GenScript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOET5 rota-VLP was a gift from Minna Hankaniemi (Addgene plasmid # 218147 ; http://n2t.net/addgene:218147 ; RRID:Addgene_218147)