AAV-mCREB
(Plasmid
#68551)
-
PurposeAAV expression of mCREB
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4650
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCREB
-
Alt namecAMP response element binding protein
-
SpeciesR. norvegicus (rat)
-
MutationS133A
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
- 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-mCREB was a gift from Eric Nestler (Addgene plasmid # 68551 ; http://n2t.net/addgene:68551 ; RRID:Addgene_68551) -
For your References section:
cAMP response element binding protein phosphorylation in nucleus accumbens underlies sustained recovery of sensorimotor gating following repeated D(2)-like receptor agonist treatment in rats. Berger AK, Green T, Siegel SJ, Nestler EJ, Hammer RP Jr. Biol Psychiatry. 2011 Feb 1;69(3):288-94. doi: 10.1016/j.biopsych.2010.08.032. Epub 2010 Oct 30. 10.1016/j.biopsych.2010.08.032 PubMed 21035786