This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAEL006511-Cas9
(Plasmid #100580)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100580 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PiggyBac
  • Backbone size w/o insert (bp) 5246
  • Total vector size (bp) 13176
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AAEL006511-hspcas9-GFP
  • Species
    Aedes aegypti, Streptococcus pyogenes
  • Insert Size (bp)
    7008
  • Promoter AAEL006511
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acggtcacggcgggcatgtcgacgcggccgcAGCGTGAACCTTGCATGCGTGCAC
  • 3′ sequencing primer AAAAGTTGGTGGTGGGGAGGCCACCGAGTATGGGCGCGCCCCGGCCGTTAACTCGAATCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Opie2-dsRed
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    926
  • Promoter Opie2
  • Tag / Fusion Protein
    • dsRED (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATAGCGATTCGAGTTAACGGCCGGGgcgcgcccatactcggtggcctccccaccac
  • 3′ sequencing primer AACATTGTCAGATCCGAGATCGGCCGGCCTAGAAGCTTTAAGATACATTGATGAGTTTGGAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAEL006511-Cas9 was a gift from Omar Akbari (Addgene plasmid # 100580 ; http://n2t.net/addgene:100580 ; RRID:Addgene_100580)
  • For your References section:

    Germline Cas9 expression yields highly efficient genome engineering in a major worldwide disease vector, Aedes aegypti. Li M, Bui M, Yang T, Bowman CS, White BJ, Akbari OS. Proc Natl Acad Sci U S A. 2017 Nov 14. pii: 201711538. doi: 10.1073/pnas.1711538114. 10.1073/pnas.1711538114 PubMed 29138316