Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28b-HRASLS3-1-132
(Plasmid #100725)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100725 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 5600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HRASLS3
  • Alt name
    PLA2G16
  • Alt name
    HREV107
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    400
  • Entrez Gene
    PLAAT3 (a.k.a. AdPLA, H-REV107, H-REV107-1, HRASLS3, HREV107, HREV107-1, HREV107-3, HRSL3, PLA2G16, PLAAT-3)
  • Promoter T7 promotor
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
  • 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28b-HRASLS3-1-132 was a gift from Byung Il Lee (Addgene plasmid # 100725 ; http://n2t.net/addgene:100725 ; RRID:Addgene_100725)
  • For your References section:

    Expression, purification and biochemical characterization of the N-terminal regions of human TIG3 and HRASLS3 proteins. Han BG, Cho JW, Cho YD, Kim SY, Yoon HJ, Song HK, Cheong HK, Jeon YH, Lee DK, Lee S, Lee BI. Protein Expr Purif. 2010 May;71(1):103-7. doi: 10.1016/j.pep.2010.01.018. Epub 2010 Jan 25. 10.1016/j.pep.2010.01.018 PubMed 20100577