pH3mCHSH2
(Plasmid #101053)

• Purpose: This is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.
• Depositing Lab: Jennifer Lodge
• Publication: Upadhya et al Fungal Genet Biol. 2017 Sep 1. pii: S1087-1845(17)30136-6. doi: 10.1016/j.fgb.2017.08.008.

Backbone

• Vector backbone: pGEMT-EASY
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 2941
• Total vector size (bp): 9120
• Vector type: Yeast Expression
• Selectable markers: G418

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cryptococcus mCherry expression plasmid
• Species: Cryptococcus neoformans
• Promoter: Cryptococcus Histone3 promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGTTGTTTCAGGCCTGCGGATG
• 3′ sequencing primer: CCTTCATCAACATTCTGACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mCherry gene is cloned from plasmid pLK25 a gift from Dr. Peter Williamson from NIH.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry