Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLentiCRISPR sgFTCD_2
(Plasmid #102313)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102313 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgFTCD_2
  • gRNA/shRNA sequence
    GGAGCCATCACACAGACCCC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    30
  • Entrez Gene
    FTCD (a.k.a. LCHC1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (unknown if destroyed)
  • 3′ cloning site BsmB1 (unknown if destroyed)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPR sgFTCD_2 was a gift from David Sabatini (Addgene plasmid # 102313 ; http://n2t.net/addgene:102313 ; RRID:Addgene_102313)
  • For your References section:

    Histidine catabolism is a major determinant of methotrexate sensitivity. Kanarek N, Keys HR, Cantor JR, Lewis CA, Chan SH, Kunchok T, Abu-Remaileh M, Freinkman E, Schweitzer LD, Sabatini DM. Nature. 2018 Jul 11. pii: 10.1038/s41586-018-0316-7. doi: 10.1038/s41586-018-0316-7. 10.1038/s41586-018-0316-7 PubMed 29995852