Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDDGFP-Leu2d-ScVrg4
(Plasmid #102334)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102334 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDDGFP-Leu2d
  • Backbone manufacturer
    Simon Newstead (Addgene plasmid # 58352)
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2, URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YGL225W
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    VRG4 (a.k.a. YGL225W, GOG5, LDB3, VAN2, VIG4)
  • Promoter GAL1
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATATACCTCTATACTTTAACG
  • 3′ sequencing primer CCAGTGAATAATTCTTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDDGFP-Leu2d-ScVrg4 was a gift from Simon Newstead (Addgene plasmid # 102334 ; http://n2t.net/addgene:102334 ; RRID:Addgene_102334)
  • For your References section:

    Structural basis of nucleotide sugar transport across the Golgi membrane. Parker JL, Newstead S. Nature. 2017 Nov 23;551(7681):521-524. doi: 10.1038/nature24464. Epub 2017 Nov 15. 10.1038/nature24464 PubMed 29143814