pVC-Ds-MCS-Ds
(Plasmid
#102416)
-
Purpose(Empty Backbone) Empty vector with a multiple cloning site flanked by Ds integration elements
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneUnknown
- Backbone size (bp) 3567
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATCCCGTACCGACCGTTATC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAuthors listed below, via MTA dated 27th August 2012.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A. Emelyanov and S. Parinov. Mifepristone-inducible LexPR system to drive and control gene expression in transgenic zebrafish. Developmental Biology, 320(1):113– 121, 2008. ISSN 00121606. doi: 10.1016/j.ydbio.2008.04.042.
A. Emelyanov, Y. Gao, N. I. Naqvi, and S. Parinov. Trans-kingdom transposition of the maize Dissociation element. Genetics, 174(3):1095–1104, 2006. ISSN 00166731. doi: 10.1534/genetics.106.061184.
Please visit https://www.biorxiv.org/content/10.1101/450684v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVC-Ds-MCS-Ds was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 102416 ; http://n2t.net/addgene:102416 ; RRID:Addgene_102416) -
For your References section:
Ac/Ds transposition for CRISPR/dCas9-SID4x epigenome modulation in zebrafish. Chong-Morrison V, Mayes S, Simoes FC, Senanayake U, Carroll DS, Riley PR, Wilson SW, Sauka-Spengler T. Biol Open. 2023 Jun 15;12(6):bio059995. doi: 10.1242/bio.059995. Epub 2023 Jun 27. 10.1242/bio.059995 PubMed 37367831