Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PB-SAM
(Plasmid #102559)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102559 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    piggybac
  • Backbone size w/o insert (bp) 3902
  • Total vector size (bp) 14443
  • Vector type
    Mammalian Expression, CRISPR ; piggybac transposon
  • Selectable markers
    Hygromycin, Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MS2-P65-HSF1_T2A_Hygro
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2523
  • Mutation
    N55K in MS2
  • Promoter EF1A

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcacttgatgtaattctc
  • 3′ sequencing primer cgtaagttatgtaacgcg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dCAS9(D10A, N863A)-VP64_T2A_Blast
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    4875
  • Mutation
    D10A and N863A in Cas9
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgctaaccatgttcatgcc
  • 3′ sequencing primer gcattacacgtcttgagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCAS9-VP64 and MS2-P65-HSF1 cassettes are from Feng Zhang's lab (Addgene #61423 and #61425).
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-SAM was a gift from Ying Liu (Addgene plasmid # 102559 ; http://n2t.net/addgene:102559 ; RRID:Addgene_102559)
  • For your References section:

    One-Step piggyBac Transposon-Based CRISPR/Cas9 Activation of Multiple Genes. Li S, Zhang A, Xue H, Li D, Liu Y. Mol Ther Nucleic Acids. 2017 Sep 15;8:64-76. doi: 10.1016/j.omtn.2017.06.007. Epub 2017 Jun 15. 10.1016/j.omtn.2017.06.007 PubMed 28918057