Rab5-L38R-mCherry
(Plasmid #102785)

• Purpose: Point mutation in Rab5 that reestablishes interaction with APPL1 when co-expressed with APPL1-N308D
• Depositing Lab: Donna Webb
• Publication: Webb Lab plasmids (unpublished)

Backbone

• Vector backbone: EGFP-C1
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 5400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rab5a
• Species: H. sapiens (human)
• Insert Size (bp): 648
• Mutation: Leucine 38 changed to Arginine
• GenBank ID: NM_004162.4
• Entrez Gene: RAB5A (a.k.a. RAB5)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (unknown if destroyed)
• 3′ cloning site: Sal1 (unknown if destroyed)
• 5′ sequencing primer: EGFP-C . CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mCherry-C2-Rab5a encodes wild-type human Rab5a,(NM_004162) as a fusion protein with mCherry. Rab5a was inserted between the Eco R1 and Sal 1 restriction sites. mCherry-C2 encodes a monomeric variant of DsRed. The backbone plasmid is pEGFP-C1 (Clontech). The C2 version of mCherry was created by insertion of a short piece of DNA between Xho 1 and EcoR1 restriction sites. In the resulting multiple cloning site, the Sac 1 restriction site has been eliminated and the Eco R1 restriction site is in frame.