pCDH-puro-EWS-FLI1
(Plasmid #102813)

• Purpose: Overexpress EWS-FLI1. 3rd generation lentiviral vector.
• Depositing Lab: Jialiang Wang
• Publication: Loganathan et al Oncotarget. 2016 Jul 12;7(28):43504-43517. doi: 10.18632/oncotarget.9762.

Backbone

• Vector backbone: pCDH-puro
• Backbone size w/o insert (bp): 7384
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: EWS-FLI1
• Species: H. sapiens (human)
• Entrez Gene: EWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Nhe 1 (unknown if destroyed)
• 3′ cloning site: Not 1 (unknown if destroyed)
• 5′ sequencing primer: CMV-F CGCAAATGGGCGGTAGGCGTG

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The cDNA sequence of EWS-FLI1 was subcloned into the NheI and NotI sites of the lentiviral vector pCDH-CMV-MCS-EF1-Puro.