-
PurposeOverexpress EWS-FLI1. 3rd generation lentiviral vector.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102813 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDH-puro
- Backbone size w/o insert (bp) 7384
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEWS-FLI1
-
SpeciesH. sapiens (human)
-
Entrez GeneEWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe 1 (unknown if destroyed)
- 3′ cloning site Not 1 (unknown if destroyed)
- 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The cDNA sequence of EWS-FLI1 was subcloned into the NheI and NotI sites of the lentiviral vector pCDH-CMV-MCS-EF1-Puro.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-puro-EWS-FLI1 was a gift from Jialiang Wang (Addgene plasmid # 102813 ; http://n2t.net/addgene:102813 ; RRID:Addgene_102813) -
For your References section:
BET bromodomain inhibitors suppress EWS-FLI1-dependent transcription and the IGF1 autocrine mechanism in Ewing sarcoma. Loganathan SN, Tang N, Fleming JT, Ma Y, Guo Y, Borinstein SC, Chiang C, Wang J. Oncotarget. 2016 Jul 12;7(28):43504-43517. doi: 10.18632/oncotarget.9762. 10.18632/oncotarget.9762 PubMed 27259270