pLKO.1P shSOD2
(Plasmid
#102976)
-
PurposeSuppression of SOD2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1P
-
Backbone manufacturerBroad Institute
- Backbone size w/o insert (bp) 7466
- Total vector size (bp) 7518
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshSOD2
-
gRNA/shRNA sequenceGTGGTGGTCATATCAATCATA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000636
-
Entrez GeneSOD2 (a.k.a. GC1, GClnc1, IPO-B, IPOB, MNSOD, MVCD6, Mn-SOD)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRCN0000005943
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1P shSOD2 was a gift from Richard Possemato (Addgene plasmid # 102976 ; http://n2t.net/addgene:102976 ; RRID:Addgene_102976) -
For your References section:
NFS1 undergoes positive selection in lung tumours and protects cells from ferroptosis. Alvarez SW, Sviderskiy VO, Terzi EM, Papagiannakopoulos T, Moreira AL, Adams S, Sabatini DM, Birsoy K, Possemato R. Nature. 2017 Nov 22. doi: 10.1038/nature24637. 10.1038/nature24637 PubMed 29168506