-
PurposeEncodes Ebola virus NP gene (Zaire ebolavirus, Mayinga) under control of the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGs
- Total vector size (bp) 7132
-
Modifications to backbonepCAGGS containing additonal multiple cloning sites
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNP gene of Ebola virus
-
Alt namenucleoprotein gene of Ebola virus
-
SpeciesZaire ebolavirus, Mayinga
-
Mutationsilent mutation (T to C) at position 928 of NP gene
-
Entrez GeneNP (a.k.a. ZEBOVgp1)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sac 1 (unknown if destroyed)
- 3′ cloning site Nhe 1 (unknown if destroyed)
- 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS_NP_EBOV was a gift from Elke Mühlberger (Addgene plasmid # 103049 ; http://n2t.net/addgene:103049 ; RRID:Addgene_103049) -
For your References section:
An RNA polymerase II-driven Ebola virus minigenome system as an advanced tool for antiviral drug screening. Nelson EV, Pacheco JR, Hume AJ, Cressey TN, Deflube LR, Ruedas JB, Connor JH, Ebihara H, Muhlberger E. Antiviral Res. 2017 Aug 12;146:21-27. doi: 10.1016/j.antiviral.2017.08.005. 10.1016/j.antiviral.2017.08.005 PubMed 28807685