Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAGGS_L_EBOV
(Plasmid #103052)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 103052 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L gene of Ebola virus
  • Species
    Zaire ebolavirus, Mayinga
  • Entrez Gene
    L (a.k.a. ZEBOVgp7)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not 1 (unknown if destroyed)
  • 3′ cloning site Sac 1 (unknown if destroyed)
  • 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS_L_EBOV was a gift from Elke Mühlberger (Addgene plasmid # 103052)
  • For your References section:

    An RNA polymerase II-driven Ebola virus minigenome system as an advanced tool for antiviral drug screening. Nelson EV, Pacheco JR, Hume AJ, Cressey TN, Deflube LR, Ruedas JB, Connor JH, Ebihara H, Muhlberger E. Antiviral Res. 2017 Aug 12;146:21-27. doi: 10.1016/j.antiviral.2017.08.005. 10.1016/j.antiviral.2017.08.005 PubMed 28807685