Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

dCas9v2
(Plasmid #103140)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 103140 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDTU-113
  • Total vector size (bp) 13958
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    dCas9-VPR
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    Removed scaffold gRNA from original plasmid

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcagtgatagagatggcgcac
  • 3′ sequencing primer ccttgggacaaggcttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCas9v2 was a gift from Jens Nielsen (Addgene plasmid # 103140 ; http://n2t.net/addgene:103140 ; RRID:Addgene_103140)
  • For your References section:

    Multiplexed CRISPR/Cas9 Genome Editing and Gene Regulation using Csy4 in Saccharomyces cerevisiae. Ferreira R, Skrekas C, Nielsen J, David F. ACS Synth Biol. 2017 Nov 21. doi: 10.1021/acssynbio.7b00259. 10.1021/acssynbio.7b00259 PubMed 29161506