dCas9v2
(Plasmid
#103140)
-
PurposeTetR inducible dCas9-VPR plasmid with pRPR-NotI-tRPR1 Csy4-ready site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDTU-113
- Total vector size (bp) 13958
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9-VPR
-
SpeciesS. cerevisiae (budding yeast)
-
MutationRemoved scaffold gRNA from original plasmid
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagtgatagagatggcgcac
- 3′ sequencing primer ccttgggacaaggcttgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dCas9v2 was a gift from Jens Nielsen (Addgene plasmid # 103140 ; http://n2t.net/addgene:103140 ; RRID:Addgene_103140) -
For your References section:
Multiplexed CRISPR/Cas9 Genome Editing and Gene Regulation using Csy4 in Saccharomyces cerevisiae. Ferreira R, Skrekas C, Nielsen J, David F. ACS Synth Biol. 2017 Nov 21. doi: 10.1021/acssynbio.7b00259. 10.1021/acssynbio.7b00259 PubMed 29161506