eGFP-KCC2
(Plasmid
#104075)
-
Purposeexpresses rat KCC2 (b isoform) with eGFP tag at the N-terminus of KCC2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP-C1
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 8157
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKCC2 (b isoform)
-
Alt nameSlc12a5
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3350
-
MutationEcoR1 site in rat KCC2 was removed by silent mutation, A3267G in rat coding sequence
-
Entrez GeneSlc12a5 (a.k.a. Kcc2)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (unknown if destroyed)
- 3′ cloning site EcoR1 (unknown if destroyed)
- 5′ sequencing primer EGFP-C . CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eGFP-KCC2 was a gift from Igor Medyna (Addgene plasmid # 104075 ; http://n2t.net/addgene:104075 ; RRID:Addgene_104075) -
For your References section:
Knocking down of the KCC2 in rat hippocampal neurons increases intracellular chloride concentration and compromises neuronal survival. Pellegrino C, Gubkina O, Schaefer M, Becq H, Ludwig A, Mukhtarov M, Chudotvorova I, Corby S, Salyha Y, Salozhin S, Bregestovski P, Medina I. J Physiol. 2011 May 15;589(Pt 10):2475-96. doi: 10.1113/jphysiol.2010.203703. Epub 2011 Mar 21. 10.1113/jphysiol.2010.203703 PubMed 21486764