Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

eGFP-KCC2
(Plasmid #104075)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104075 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP-C1
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 8157
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KCC2 (b isoform)
  • Alt name
    Slc12a5
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3350
  • Mutation
    EcoR1 site in rat KCC2 was removed by silent mutation, A3267G in rat coding sequence
  • Entrez Gene
    Slc12a5 (a.k.a. Kcc2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (unknown if destroyed)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer EGFP-C . CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eGFP-KCC2 was a gift from Igor Medyna (Addgene plasmid # 104075 ; http://n2t.net/addgene:104075 ; RRID:Addgene_104075)
  • For your References section:

    Knocking down of the KCC2 in rat hippocampal neurons increases intracellular chloride concentration and compromises neuronal survival. Pellegrino C, Gubkina O, Schaefer M, Becq H, Ludwig A, Mukhtarov M, Chudotvorova I, Corby S, Salyha Y, Salozhin S, Bregestovski P, Medina I. J Physiol. 2011 May 15;589(Pt 10):2475-96. doi: 10.1113/jphysiol.2010.203703. Epub 2011 Mar 21. 10.1113/jphysiol.2010.203703 PubMed 21486764