pcDNA3.1(-)-LZ-CD95L
(Plasmid
#104349)
-
PurposeExpresses human CD95L leucine zipper in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1(-)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6117
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD95L leucine zipper
-
SpeciesH. sapiens (human)
-
Insert Size (bp)717
-
GenBank IDNM_000639.2
-
Entrez GeneFASLG (a.k.a. ALPS1B, APT1LG1, APTL, CD178, CD95-L, CD95L, FASL, TNFSF6, TNLG1A)
- Promoter CMV
-
Tag
/ Fusion Protein
- octahistidine tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthetic DNA encoding a fusion of an improved IL2 signal sequence (Zhang et al. 2005 & Naito et al. 2013), an octahistidine-tagged-leucine zipper motif, a flexible 17aa linker (Naito et al. 2013) and the death inducing, c-terminal extracellular domain (aa137-208) of CD95L. The cloning strategy omits the proteolytically-susceptible extracellular stalk region (aa102-136), but includes the extracellular self-assembly domain (aa137-183; Orlinick et al. 1997). NTA column purified LZ-CD95L produced in expi393 cells is highly active (IC50 Jurkat E6-1 cells < 50ng/ml). Human CD95L is also active in inducing cell death in murine thymocytes (McLellan et al. 2000). Note, during following transient transfection, rising levels of LZ-CD95L in the culture supernatant induce cell death in HEK293FT and expi293. Users could explore co-transfection of this vector with a c-FLIP-encoding vector, select CD95L resistant HEK293 variants, or use other CD95L-resistant mammalian cell lines to maximise LZ-CD95L yields.
References:
McLellan AD, Terbeck G, Mengling T, Starling GC, Kiener PA, Gold R, Bröcker EB, Leverkus M, Kämpgen E. Differential susceptibility to CD95 (Apo-1/Fas) and MHC class II-induced apoptosis during murine dendritic cell development. Cell Death Differ. 2000 Oct;7(10):933-8.
Naito M, Hainz U, Burkhardt UE, Fu B, Ahove D, Stevenson KE, Rajasagi M, Zhu B, Alonso A, Witten E, Matsuoka K, Neuberg D, Duke-Cohan JS, Wu CJ, and Freeman GJ. CD40L-Tri, a novel formulation of recombinant human CD40L that effectively activates B cells. Cancer Immunol Immunother 2013; 62:347-357.
Orlinick JR, Elkon KB, and Chao MV. Separate domains of the human fas ligand dictate self-association and receptor binding. J Biol Chem 1997; 272:32221-32229.
Zhang L, Leng Q, and Mixson AJ. Alteration in the IL-2 signal peptide affects secretion of proteins in vitro and in vivo. The Journal of Gene Medicine 2005; 7:354-365.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(-)-LZ-CD95L was a gift from Alexander McLellan (Addgene plasmid # 104349 ; http://n2t.net/addgene:104349 ; RRID:Addgene_104349)