-
Purposepolycistronic vector for expression of E. coli core RNAP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET
-
Backbone manufacturerNovagen
- Total vector size (bp) 15205
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerpoA-rpoB-rpoC-6xHis and rpoZ
-
SpeciesE. coli
-
Entrez GenerpoA (a.k.a. b3295, ECK3282, pez, phs, sez)
-
Entrez GenerpoB (a.k.a. b3987, ECK3978, ftsR, groN, nitB, rif, ron, sdgB, stl, stv, tabD)
-
Entrez GenerpoC (a.k.a. b3988, ECK3979, tabB)
-
Entrez GenerpoZ (a.k.a. b3649, ECK3639, spoS)
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ cloning site Nde 1 (unknown if destroyed)
- 3′ cloning site Not 1 (unknown if destroyed)
- 5′ sequencing primer T7 TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid pVS10 encodes the E. coli rpoA-rpoB-rpoC [His6] and
rpoZ ORFs under control of T7 promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PVS10 was a gift from Irina Artsimovitch (Addgene plasmid # 104398 ; http://n2t.net/addgene:104398 ; RRID:Addgene_104398) -
For your References section:
Purification of bacterial RNA polymerase: tools and protocols. Svetlov V, Artsimovitch I. Methods Mol Biol. 2015;1276:13-29. doi: 10.1007/978-1-4939-2392-2_2. 10.1007/978-1-4939-2392-2_2 PubMed 25665556