Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PIA586
(Plasmid #104399)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104399 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28b
  • Backbone size w/o insert (bp) 5368
  • Total vector size (bp) 7153
  • Modifications to backbone
    filled in XhoI site in pET28B, recloned XbaI-HindIII fragment from pET70-σ70 into pIA585 = unique XhoI site in rpoD
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rpoD
  • Species
    E. coli
  • Promoter T7
  • Tag / Fusion Protein
    • His6 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba 1 (unknown if destroyed)
  • 3′ cloning site Hind III (unknown if destroyed)
  • 5′ sequencing primer T7 TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

T7P–His6-rpoD; N-terminally tagged σ70 subunit under control of the T7 gene 10 promoter

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PIA586 was a gift from Irina Artsimovitch (Addgene plasmid # 104399 ; http://n2t.net/addgene:104399 ; RRID:Addgene_104399)
  • For your References section:

    Purification of bacterial RNA polymerase: tools and protocols. Svetlov V, Artsimovitch I. Methods Mol Biol. 2015;1276:13-29. doi: 10.1007/978-1-4939-2392-2_2. 10.1007/978-1-4939-2392-2_2 PubMed 25665556