pSpCas9 (BB)-2A-GFP gamma-tubulin sg
(Plasmid
#104437)
-
PurposeKnockdown the expression of gamma-tubulin in human cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9 (BB)-2A-GFP
-
Backbone manufacturerDr. Zhang
- Backbone size w/o insert (bp) 9289
- Total vector size (bp) 9309
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegamma-tubulin sgRNA
-
Alt nameNA
-
gRNA/shRNA sequenceTACAGTTGGGCCAGTGCGGC
-
SpeciesH. sapiens (human)
-
GenBank ID
-
Tag
/ Fusion Protein
- The gamma-tubulin sgRNA is coexpressed with 3xFLAG-Cas9-GFP
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was a gift from Dr. Zhang
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9 (BB)-2A-GFP gamma-tubulin sg was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104437 ; http://n2t.net/addgene:104437 ; RRID:Addgene_104437) -
For your References section:
Characterization of gamma-tubulin filaments in mammalian cells. Lindstrom L, Alvarado-Kristensson M. Biochim Biophys Acta. 2017 Oct 16. pii: S0167-4889(17)30283-5. doi: 10.1016/j.bbamcr.2017.10.008. 10.1016/j.bbamcr.2017.10.008 PubMed 29050966
