Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LI D-E V5
(Plasmid #104519)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104519 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57
  • Backbone manufacturer
    Parniske lab
  • Backbone size w/o insert (bp) 2458
  • Vector type
    Cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3*V5 gene
  • Species
    Synthetic
  • Insert Size (bp)
    129

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGGTTTTCCCAGTCACGACGT
  • 3′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LI D-E V5 was a gift from Thomas Lahaye (Addgene plasmid # 104519 ; http://n2t.net/addgene:104519 ; RRID:Addgene_104519)
  • For your References section:

    A modular toolbox for Golden-Gate-based plasmid assembly streamlines generation of Ralstonia solanacearum species complex knockout strains and multi-cassette complementation constructs. Wu D, Schandry N, Lahaye T. Mol Plant Pathol. 2017 Oct 27. doi: 10.1111/mpp.12632. 10.1111/mpp.12632 PubMed 29077245