OMM PKA Reporter
(Plasmid #104550)

• Purpose: Expresses Tom20-mTurquoise2-VASP at the outer mitochondrial membrane of mammalian cells.
• Depositing Lab: David Lawrence
• Publication: O'Banion et al Cell Chem Biol. 2017 Oct 25. pii: S2451-9456(17)30355-0. doi: 10.1016/j.chembiol.2017.09.011.

Backbone

• Vector backbone: pEF1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 5736
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tom20 - mTurquoise2 - VASP 148-164
• Alt name: PKA reporter
• Species: Synthetic
• Insert Size (bp): 1005
• Promoter: EF1 alpha
• Tag / Fusion Protein:
  • mTurqouise2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AGATCTCGAGCTCAAGCTTC
• 3′ sequencing primer: GTAACCATTATAAGCTGCAA

Resource Information

• Supplemental Documents:
  • pEF1-Tom20-HA-mT-VASP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry