Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP Tubulin K40Q
(Plasmid #105302)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105302 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    alpha tubulin
  • Alt name
    TUBA1B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1350
  • Mutation
    K40Q
  • GenBank ID
    NM_006082
  • Entrez Gene
    TUBA1B (a.k.a. K-ALPHA-1)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original pEGFP-Tub from Clontech. Mutation in Tubulin was introduced by using site-directed mutagenesis kit (Stratagene)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP Tubulin K40Q was a gift from Kenneth Yamada (Addgene plasmid # 105302 ; http://n2t.net/addgene:105302 ; RRID:Addgene_105302)
  • For your References section:

    MYPT1 regulates contractility and microtubule acetylation to modulate integrin adhesions and matrix assembly. Joo EE, Yamada KM. Nat Commun. 2014 Mar 25;5:3510. doi: 10.1038/ncomms4510. 10.1038/ncomms4510 PubMed 24667306