Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmKikGR Actin
(Plasmid #105315)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105315 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmKikGRNB
  • Backbone manufacturer
    modified pEGFP-C1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    actin beta
  • Alt name
    ACTB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1100
  • Entrez Gene
    ACTB (a.k.a. BKRNS, BNS, BRWS1, CSMH, DDS1, PS1TP5BP1, THC8)
  • Tag / Fusion Protein
    • KikGR (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site Xba1 (unknown if destroyed)
  • 5′ sequencing primer TCCAGTTGCCAGACTATCAC
  • 3′ sequencing primer ATGTTTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pmKikGR was constructed by inserting sequence corresponding to mKikGR with Kozak sequence to replace EGFP in Nhe1 /BglII sites of pEGFP NBC1. mKikGR was from Dr. Atsushi Miyawaki (Riken BSI).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmKikGR Actin was a gift from Kenneth Yamada (Addgene plasmid # 105315 ; http://n2t.net/addgene:105315 ; RRID:Addgene_105315)
  • For your References section:

    Micro-environmental control of cell migration--myosin IIA is required for efficient migration in fibrillar environments through control of cell adhesion dynamics. Doyle AD, Kutys ML, Conti MA, Matsumoto K, Adelstein RS, Yamada KM. J Cell Sci. 2012 May 1;125(Pt 9):2244-56. doi: 10.1242/jcs.098806. Epub 2012 Feb 10. 10.1242/jcs.098806 PubMed 22328520