pJOG174
(Plasmid
#105396)
-
PurposeSynthetic biology
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAGM1301 (Engler et al., 2014)
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemVenus (GFP variant)
-
MutationBsaI/ BpiI restriction sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer CTTTGAGTGAGCTGATACCG
- 3′ sequencing primer GGGTTCCGCGCACATTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJOG174 was a gift from Johannes Stuttmann (Addgene plasmid # 105396 ; http://n2t.net/addgene:105396 ; RRID:Addgene_105396) -
For your References section:
Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system. Gantner J, Ordon J, Ilse T, Kretschmer C, Gruetzner R, Lofke C, Dagdas Y, Burstenbinder K, Marillonnet S, Stuttmann J. PLoS One. 2018 May 30;13(5):e0197185. doi: 10.1371/journal.pone.0197185. eCollection 2018. 10.1371/journal.pone.0197185 PubMed 29847550