Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJOG822
(Plasmid #105430)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105430 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICH41308 (Engler et al., 2014)
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YFP fused to SV40 Nuclear Localisation Signal
  • Mutation
    BsaI/ BpiI restriction sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer CTTTGAGTGAGCTGATACCG
  • 3′ sequencing primer GGGTTCCGCGCACATTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJOG822 was a gift from Johannes Stuttmann (Addgene plasmid # 105430 ; http://n2t.net/addgene:105430 ; RRID:Addgene_105430)
  • For your References section:

    Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system. Gantner J, Ordon J, Ilse T, Kretschmer C, Gruetzner R, Lofke C, Dagdas Y, Burstenbinder K, Marillonnet S, Stuttmann J. PLoS One. 2018 May 30;13(5):e0197185. doi: 10.1371/journal.pone.0197185. eCollection 2018. 10.1371/journal.pone.0197185 PubMed 29847550