-
PurposeT7 promotor drives in vitro transcription of mEGFP-tagged Histon MAP4 mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEMHE
- Backbone size w/o insert (bp) 3120
- Total vector size (bp) 7254
-
Vector typein vitro Transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAP4
-
Alt nameMAP-4; Mtap4; Mtap-4; AA407148
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001205330.1
-
Entrez GeneMap4 (a.k.a. AA407148, MAP-4, Mtap-4, Mtap4)
- Promoter T7
-
Tag
/ Fusion Protein
- mEGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer AAGGCGATTAAGTTGGGTAACG
- 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEMHE-mEGFP-Map4 was a gift from Melina Schuh (Addgene plasmid # 105571 ; http://n2t.net/addgene:105571 ; RRID:Addgene_105571) -
For your References section:
A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837