Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pT7-7 asyn K32R/K34R
(Plasmid #105741)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105741 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT7-7
  • Backbone size w/o insert (bp) 2438
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    alpha-synuclein K32R/K34R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    476
  • Mutation
    K32R/K34R
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGG)
  • 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-7 asyn K32R/K34R was a gift from Hilal Lashuel (Addgene plasmid # 105741 ; http://n2t.net/addgene:105741 ; RRID:Addgene_105741)