Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

hROSA26 CRISPR-pX330
(Plasmid #105927)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105927 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hROSA26 gRNA
  • gRNA/shRNA sequence
    TTGCAGCTCGCGCCGGTTTT
  • Species
    H. sapiens (human)
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer aggctgttagagagataattgg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Based on pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hROSA26 CRISPR-pX330 was a gift from Masato Kanemaki (Addgene plasmid # 105927 ; http://n2t.net/addgene:105927 ; RRID:Addgene_105927)
  • For your References section:

    Dynein-Dynactin-NuMA clusters generate cortical spindle-pulling forces as a multi-arm ensemble. Okumura M, Natsume T, Kanemaki MT, Kiyomitsu T. Elife. 2018 May 31;7. pii: 36559. doi: 10.7554/eLife.36559. 10.7554/eLife.36559 PubMed 29848445