PCDNA3-TADA1-HFD(140-230)
(Plasmid
#105984)
-
Purposetransient express TADA1-HFD fragment in HEK 293T cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTADA1-HFD (140-230)
-
SpeciesM. musculus (mouse)
-
Entrez GeneTada1 (a.k.a. 2900026B15Rik, D1Ertd251e, Staf42, Tada1l)
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCDNA3-TADA1-HFD(140-230) was a gift from Christopher Vakoc (Addgene plasmid # 105984 ; http://n2t.net/addgene:105984 ; RRID:Addgene_105984) -
For your References section:
A TFIID-SAGA Perturbation that Targets MYB and Suppresses Acute Myeloid Leukemia. Xu Y, Milazzo JP, Somerville TDD, Tarumoto Y, Huang YH, Ostrander EL, Wilkinson JE, Challen GA, Vakoc CR. Cancer Cell. 2018 Jan 8;33(1):13-28.e8. doi: 10.1016/j.ccell.2017.12.002. 10.1016/j.ccell.2017.12.002 PubMed 29316427