SID4x-dCas9-KRAB
(Plasmid #106399)

• Purpose: Expresses catalytically inactive dCas9 with N-terminal fusion of Sin3a Interacting Domain (SID) and C-terminal fusion of repressive KRAB domain
• Depositing Lab: Jason Gertz
• Publication: Carleton et al Cell Syst. 2017 Oct 25;5(4):333-344.e5. doi: 10.1016/j.cels.2017.08.011. Epub 2017 Sep 27.

Backbone

• Vector backbone: pAC95-pmax (Addgene: 48227)
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 8792
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SID4x
• Species: H. sapiens (human)
• Insert Size (bp): 466
• GenBank ID: NM_002357
• Entrez Gene: MXD1 (a.k.a. BHLHC58, MAD, MAD1)
• Tags / Fusion Proteins:
  • HA (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SgrAI (not destroyed)
• 3′ cloning site: PfiMI (not destroyed)
• 5′ sequencing primer: CAATAGAAACTGGGCTTGTCG
• 3′ sequencing primer: TCGTGCTTCTTATCCTCTTCC

Gene/Insert 2

• Gene/Insert name: KRAB
• Species: H. sapiens (human)
• Insert Size (bp): 225
• GenBank ID: NM_015394
• Entrez Gene: ZNF10 (a.k.a. KOX1)
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: AGAAGAGAAAGGTGGAGGCC
• 3′ sequencing primer: CGTCACCGCATGTTAGAAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry