pGL3-U6-sgRNA-PGK-puromycin-AflII
(Plasmid
#106404)
-
Purpose(Empty Backbone) Empty guide RNA cloning vector with an AflII site added from Addgene 41824
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-U6-sgRNA-PGK-puromycin (Addgene: 51133)
- Backbone size (bp) 4952
-
Modifications to backboneThe MCS from Addgene 41824 containing an AflII site was introduced to facilitate Gibson assembly cloning of gRNA target sequences. In this cloning process, an EcoRI site in the original backbone was destroyed.
-
Vector typeMammalian Expression
- Promoter U6
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 3′ sequencing primer AAAAAAAGCACCGACTCGGTGCCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-U6-sgRNA-PGK-puromycin-AflII was a gift from Jason Gertz (Addgene plasmid # 106404 ; http://n2t.net/addgene:106404 ; RRID:Addgene_106404) -
For your References section:
Multiplex Enhancer Interference Reveals Collaborative Control of Gene Regulation by Estrogen Receptor alpha-Bound Enhancers. Carleton JB, Berrett KC, Gertz J. Cell Syst. 2017 Oct 25;5(4):333-344.e5. doi: 10.1016/j.cels.2017.08.011. Epub 2017 Sep 27. 10.1016/j.cels.2017.08.011 PubMed 28964699