pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA
(Plasmid #107270)

• Purpose: Expresses Cas9 upon induction with doxicycline.
• Depositing Lab: Pablo Menéndez
• Publication: Castano et al Stem Cell Res. 2017 May;21:137-140. doi: 10.1016/j.scr.2017.04.011. Epub 2017 Apr 22.

Backbone

• Vector backbone: N/A
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: hSpCas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4101
• Promoter: TRE
• Tags / Fusion Proteins:
  • 3xFlag (N terminal on insert)
  • Nucleoplasmin NLS (C terminal on insert)
  • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GTAAAACGACGGCCAGT

Gene/Insert 2

• Gene/Insert name: rtTA
• Insert Size (bp): 747
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: caattacggggtcattagttcatag
• 3′ sequencing primer: gggagcatgtcaaggtcaaaatc

Gene/Insert 3

• Gene/Insert name: bGH polyA-SV40polyA
• Insert Size (bp): 416

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • #225. Puro-Cas9 poly A-CAG-rtTA AAVS1 donor.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Puro-Cas9 donor vector (Addgene #58409)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry