pX-APRT-sg2
(Plasmid
#107274)
-
PurposeAPRT sgRNA-2 and Cas9 expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPRT sgRNA-2
-
gRNA/shRNA sequenceGGCAGCGTTCATGGTTCCTG
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX-APRT-sg2 was a gift from Knut Woltjen (Addgene plasmid # 107274 ; http://n2t.net/addgene:107274 ; RRID:Addgene_107274) -
For your References section:
Microhomology-assisted scarless genome editing in human iPSCs. Kim SI, Matsumoto T, Kagawa H, Nakamura M, Hirohata R, Ueno A, Ohishi M, Sakuma T, Soga T, Yamamoto T, Woltjen K. Nat Commun. 2018 Mar 5;9(1):939. doi: 10.1038/s41467-018-03044-y. 10.1038/s41467-018-03044-y PubMed 29507284