Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-AICD-NLS-IRES-hrGFP
(Plasmid #107543)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107543 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-IRES-hrGFP
  • Backbone manufacturer
    Agilent Technologies
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AICD-NLS
  • Species
    H. sapiens (human)
  • Mutation
    None
  • Entrez Gene
    APP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ATTCTGAGTCCAAGCTAGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Flag tag is not in frame with the insert

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-AICD-NLS-IRES-hrGFP was a gift from Hélène Marie (Addgene plasmid # 107543 ; http://n2t.net/addgene:107543 ; RRID:Addgene_107543)
  • For your References section:

    Physiological and pathophysiological control of synaptic GluN2B-NMDA receptors by the C-terminal domain of amyloid precursor protein. Pousinha PA, Mouska X, Raymond EF, Gwizdek C, Dhib G, Poupon G, Zaragosi LE, Giudici C, Bethus I, Pacary E, Willem M, Marie H. Elife. 2017 Jul 6;6. doi: 10.7554/eLife.25659. 10.7554/eLife.25659 PubMed 28682239