Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCRISPRa_VPR_yl
(Plasmid #107677)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107677 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2623
  • Total vector size (bp) 13375
  • Vector type
    Yeast Expression, CRISPR, Synthetic Biology
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Codon optimized dCas9-VPR
  • Species
    Synthetic
  • Insert Size (bp)
    5715
  • Promoter UAS1B8-TEF(136)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAAAACGACGGCCAGT
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA expression cassette
  • Species
    Synthetic
  • Insert Size (bp)
    525
  • Promoter SCR1'-tRNA

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCATTTATCAGGGTTATTGTCTCATGAG
  • 3′ sequencing primer CACGAGCAGCTTGCCTATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene material #44380 (UAS1B8-TEF promoter) is used to express Cas9

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRa_VPR_yl was a gift from Ian Wheeldon (Addgene plasmid # 107677 ; http://n2t.net/addgene:107677 ; RRID:Addgene_107677)
  • For your References section:

    Multiplexed CRISPR activation of cryptic sugar metabolism enables Yarrowia lipolytica growth on cellobiose. Schwartz C, Curtis N, Lobs AK, Wheeldon I. Biotechnol J. 2018 May 5:e1700584. doi: 10.1002/biot.201700584. 10.1002/biot.201700584 PubMed 29729131