Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pJJB302
(Plasmid #107694)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107694 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMOD_A
  • Total vector size (bp) 7189
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas13a
  • Alt name
    C2c2
  • Species
    Dicot
  • Promoter OsActin

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACAAATGCAGCCTCGTGCGG
  • 3′ sequencing primer GTGCGATGAACCCCTATTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a MOD_A plasmid compatible with the Cermek et al. toolkit.
https://www.addgene.org/browse/article/28189956/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJJB302 was a gift from Daniel Voytas (Addgene plasmid # 107694 ; http://n2t.net/addgene:107694 ; RRID:Addgene_107694)
  • For your References section:

    RNA targeting with CRISPR-Cas13. Abudayyeh OO, Gootenberg JS, Essletzbichler P, Han S, Joung J, Belanto JJ, Verdine V, Cox DBT, Kellner MJ, Regev A, Lander ES, Voytas DF, Ting AY, Zhang F. Nature. 2017 Oct 4. doi: 10.1038/nature24049. 10.1038/nature24049 PubMed 28976959