Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
(Plasmid #107728)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107728 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (Addgene #48138)
  • Backbone manufacturer
    Feng Zhang Lab
  • Backbone size w/o insert (bp) 9288
  • Total vector size (bp) 9291
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MAPRE1 gRNA #3 (targets Exon 1)
  • Alt name
    EB1
  • gRNA/shRNA sequence
    ATGTCGACTTAGGTTATCAC
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_012325.2
  • Entrez Gene
    MAPRE1 (a.k.a. EB1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ACGATACAAGGCTGTTAGAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For a detailed protocol on knocking out EB1 in human cell lines by CRISPR/Cas9, see our protocol on "Protocol Exchange" (doi and link can be found below)

For rapidly cloning gRNA sequences into pSpCAS9(BB)-2a-GFP in a single RE digestion/ ligation step, see support protocol 3

Generation of cell lines with light-controlled microtubule dynamics
Torsten Wittmann & Jeffrey van Haren
Protocol Exchange (2018) doi:10.1038/protex.2017.155
https://www.nature.com/protocolexchange/protocols/6427

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3 was a gift from Torsten Wittmann (Addgene plasmid # 107728 ; http://n2t.net/addgene:107728 ; RRID:Addgene_107728)
  • For your References section:

    Local control of intracellular microtubule dynamics by EB1 photodissociation. van Haren J, Charafeddine RA, Ettinger A, Wang H, Hahn KM, Wittmann T. Nat Cell Biol. 2018 Jan 29. pii: 10.1038/s41556-017-0028-5. doi: 10.1038/s41556-017-0028-5. 10.1038/s41556-017-0028-5 [pii] PubMed 29379139