TetO-FUW-BICRAL-FLAG-pgk-puro
(Plasmid
#107732)
-
PurposeTet inducible lentiviral C-terminal FLAG BICRAL (GLTSCR1L) ORF
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTetO-FUW-pgk-puro
- Backbone size w/o insert (bp) 9542
- Total vector size (bp) 12822
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBICRAL
-
Alt nameGLTSCR1L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3273
-
GenBank IDNM_001318819
-
Entrez GeneBICRAL (a.k.a. GLTSCR1L, KIAA0240)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAGAGCTCGTTTAGTGAACCG
- 3′ sequencing primer CGCCAAGTGCCCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySubcloned from an Novogen construct 762821-2
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-BICRAL-FLAG-pgk-puro was a gift from Emily Dykhuizen (Addgene plasmid # 107732 ; http://n2t.net/addgene:107732 ; RRID:Addgene_107732) -
For your References section:
Glioma tumor suppressor candidate region gene 1 (GLTSCR1) and its paralog GLTSCR1-like form SWI/SNF chromatin remodeling subcomplexes. Alpsoy A, Dykhuizen EC. J Biol Chem. 2018 Jan 26. pii: RA117.001065. doi: 10.1074/jbc.RA117.001065. 10.1074/jbc.RA117.001065 PubMed 29374058