Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

TetO-FUW-BICRAL-FLAG-pgk-puro
(Plasmid #107732)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107732 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    TetO-FUW-pgk-puro
  • Backbone size w/o insert (bp) 9542
  • Total vector size (bp) 12822
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BICRAL
  • Alt name
    GLTSCR1L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3273
  • GenBank ID
    NM_001318819
  • Entrez Gene
    BICRAL (a.k.a. GLTSCR1L, KIAA0240)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAGAGCTCGTTTAGTGAACCG
  • 3′ sequencing primer CGCCAAGTGCCCAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Subcloned from an Novogen construct 762821-2
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-BICRAL-FLAG-pgk-puro was a gift from Emily Dykhuizen (Addgene plasmid # 107732 ; http://n2t.net/addgene:107732 ; RRID:Addgene_107732)
  • For your References section:

    Glioma tumor suppressor candidate region gene 1 (GLTSCR1) and its paralog GLTSCR1-like form SWI/SNF chromatin remodeling subcomplexes. Alpsoy A, Dykhuizen EC. J Biol Chem. 2018 Jan 26. pii: RA117.001065. doi: 10.1074/jbc.RA117.001065. 10.1074/jbc.RA117.001065 PubMed 29374058