Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV_CWSL.hSyn.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3
(Plasmid #107737)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107737 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CW3SL-EGFP
  • Backbone manufacturer
    Bong-Kiun Kaang
  • Backbone size w/o insert (bp) 4476
  • Total vector size (bp) 7252
  • Modifications to backbone
    A fragment containing the hSyn promoter, LoxP/Lox2272, and reverse-complemented Synaptophysin-GCaMP6s.P2A.mRuby3 was swapped into replace EGFP and the shortened CamKII promoter in the CW3SL backbone. Total AAV packaging size (including ITRs and DNA in between) is 4656 bp.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    synaptophysin-GCaMP6s, mRuby3
  • Alt name
    synaptophysin-GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Alt name
    mRuby3
  • Species
    R. norvegicus (rat); A. victoria (jellyfish)
  • Insert Size (bp)
    3913
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstAPI (not destroyed)
  • 3′ cloning site SrfI (not destroyed)
  • 5′ sequencing primer GGCCGCAGATGGGGGGGATG
  • 3′ sequencing primer ATCCAGAGGTTGATTATCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Sequences were produced de novo based on published sequences. GCaMP6s based on sequences published by Douglas Kim et al, Janelia Research Campus in Chen et al, 2013 PMID: 23868258. The Synaptophysin-GCaMP6s fusion sequence was previously published by Ofer Yizhar's lab in Mahn et al, 2016 PMID: 26950004. mRuby3 sequence synthesis was based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This plasmid contains a naturally-occurring a G→T mutation in one of the AAV ITRs at position 570bp. However, we have still obtained high titer AAV using this plasmid and robust in vivo expression in Cre+ mouse neurons.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_CWSL.hSyn.DIO.Synaptophysin-GCaMP6s.P2A.mRuby3 was a gift from Rylan Larsen (Addgene plasmid # 107737 ; http://n2t.net/addgene:107737 ; RRID:Addgene_107737)