Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #107738)


Item Catalog # Description Quantity Price (USD)
Plasmid 107738 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Jonathan Ting
  • Backbone size w/o insert (bp) 7022
  • Total vector size (bp) 6091
  • Modifications to backbone
    A fragment containing codon-optimized Cre Recombinase, the self-cleaving peptide sequence P2A, and the red fluorescent protein dTomato was swapped into replace SSFO-EYFP-P2A-nlsdTomato in the backbone. Total AAV packaging size (including ITRs and DNA in between) is 3495 bp.
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    Cre, dTomato
  • Insert Size (bp)
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGTCGAGAAACCGGCTAGAG
  • 3′ sequencing primer CCAGAGGTTGATTATCGATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The sequence for codon-optimized Cre recombinase was originally published by Rolf Sprengel's lab in Shimshek et al, 2002 (PMID: 11835670) . The sequence for dTomato was originally published by Roger Tsien's lab in Shaner et al, 2008 (PMID: 18454154)
  • Terms and Licenses

Depositor Comments

This plasmid can be used to express codon-optimized Cre and, separately, the red fluorescent dTomato. It is useful for studies aiming to fluorescently label cells that have undergone Cre-recombination of a Lox-containing DNA sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-Cre-P2A-dTomato was a gift from Rylan Larsen (Addgene plasmid # 107738 ; ; RRID:Addgene_107738)