-
PurposeCan be used to express Cre recombinase and simultaneously the red fluorescent protein dTomato. Can also be used to create adeno-associated virus for delivery of these genes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107738 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | |
AAV1 | 107738-AAV1 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | |||
AAV2 | 107738-AAV2 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | |||
AAV5 | 107738-AAV5 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | |||
AAV8 | 107738-AAV8 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | |||
AAV9 | 107738-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | |||
AAV Retrograde | 107738-AAVrg | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-hSyn1-DIO-SSFO-EYFP-P2A-nlsdTomato-WPRE-BGHpA
-
Backbone manufacturerJonathan Ting
- Backbone size w/o insert (bp) 7022
- Total vector size (bp) 6091
-
Modifications to backboneA fragment containing codon-optimized Cre Recombinase, the self-cleaving peptide sequence P2A, and the red fluorescent protein dTomato was swapped into replace SSFO-EYFP-P2A-nlsdTomato in the backbone. Total AAV packaging size (including ITRs and DNA in between) is 3495 bp.
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre, dTomato
-
Insert Size (bp)1839
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGTCGAGAAACCGGCTAGAG
- 3′ sequencing primer CCAGAGGTTGATTATCGATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe sequence for codon-optimized Cre recombinase was originally published by Rolf Sprengel's lab in Shimshek et al, 2002 (PMID: 11835670) . The sequence for dTomato was originally published by Roger Tsien's lab in Shaner et al, 2008 (PMID: 18454154)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid can be used to express codon-optimized Cre and, separately, the red fluorescent dTomato. It is useful for studies aiming to fluorescently label cells that have undergone Cre-recombination of a Lox-containing DNA sequence.
Information for AAV1 (Catalog # 107738-AAV1) ( Back to top )
Purpose
Ready-to-use AAV1 particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA.
hSyn-driven expression of Cre and dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene dTomato (physically separate, not a fusion protein)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV2 (Catalog # 107738-AAV2) ( Back to top )
Purpose
Ready-to-use AAV2 particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA.
hSyn-driven expression of Cre and dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV2
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene dTomato (physically separate, not a fusion protein)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV5 (Catalog # 107738-AAV5) ( Back to top )
Purpose
Ready-to-use AAV5 particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA.
hSyn-driven expression of Cre and dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene dTomato (physically separate, not a fusion protein)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV8 (Catalog # 107738-AAV8) ( Back to top )
Purpose
Ready-to-use AAV8 particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA.
hSyn-driven expression of Cre and dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV8
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene dTomato (physically separate, not a fusion protein)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV9 (Catalog # 107738-AAV9) ( Back to top )
Purpose
Ready-to-use AAV9 particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA.
hSyn-driven expression of Cre and dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene dTomato (physically separate, not a fusion protein)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV Retrograde (Catalog # 107738-AAVrg) ( Back to top )
Purpose
Ready-to-use AAV Retrograde particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA.
hSyn-driven expression of Cre and dTomato (physically separate). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV retrograde (AAVrg)
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene dTomato (physically separate, not a fusion protein)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-Cre-P2A-dTomato was a gift from Rylan Larsen (Addgene plasmid # 107738 ; http://n2t.net/addgene:107738 ; RRID:Addgene_107738)
For viral preps, please replace (Addgene plasmid # 107738) in the above sentence with: (Addgene viral prep # 107738-AAV1), (Addgene viral prep # 107738-AAV2), (Addgene viral prep # 107738-AAV5), (Addgene viral prep # 107738-AAV8), (Addgene viral prep # 107738-AAV9), or (Addgene viral prep # 107738-AAVrg)