Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHW564 (Pmyo-2::cGAL-N(C1A)::let-858 3'UTR)
(Plasmid #107739)


Item Catalog # Description Quantity Price (USD)
Plasmid 107739 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Mutation
    change the first cysteine of gp41-1 N-intein to alanine
  • Promoter C. elegans myo-2 promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer oHW10f, TGAGCGGATAACAATTTCAC
  • 3′ sequencing primer oHW233r, cgaattgggagacggaaagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHW564 (Pmyo-2::cGAL-N(C1A)::let-858 3'UTR) was a gift from Paul Sternberg (Addgene plasmid # 107739 ; ; RRID:Addgene_107739)
  • For your References section:

    Split cGAL, an intersectional strategy using a split intein for refined spatiotemporal transgene control in Caenorhabditiselegans. Wang H, Liu J, Yuet KP, Hill AJ, Sternberg PW. Proc Natl Acad Sci U S A. 2018 Mar 26. pii: 1720063115. doi: 10.1073/pnas.1720063115. 10.1073/pnas.1720063115 PubMed 29581308