pHJ8: CadC-VHH-Control
(Plasmid
#108243)
-
Purposemembrane bound transcription activator CadC fusing with anti-RNase A antibody
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB4K5
- Backbone size w/o insert (bp) 6438
- Total vector size (bp) 7446
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMembrane bound transcription activator CadC fusing with anti-RNase A VHH antibody
-
SpeciesSynthetic
-
Insert Size (bp)1008
- Promoter pLacO1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGCAACTGAAACGATTCGGATC
- 3′ sequencing primer CACCAACGGGTTATTGATAGAACGC (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHJ8: CadC-VHH-Control was a gift from Jerome Bonnet (Addgene plasmid # 108243 ; http://n2t.net/addgene:108243 ; RRID:Addgene_108243) -
For your References section:
A Modular Receptor Platform To Expand the Sensing Repertoire of Bacteria. Chang HJ, Mayonove P, Zavala A, De Visch A, Minard P, Cohen-Gonsaud M, Bonnet J. ACS Synth Biol. 2017 Oct 30. doi: 10.1021/acssynbio.7b00266. 10.1021/acssynbio.7b00266 PubMed 28946740