pGEX4T2 RANK-L
(Plasmid #108571)

• Purpose: Encodes C-terminal part of RANKL (aa158-aa316) with a GST N-terminal tag
• Depositing Lab: Jean-Claude Scimeca
• Publication: Beranger et al J Bone Miner Res. 2007 Jul;22(7):975-83. doi: 10.1359/jbmr.070406.

Backbone

• Vector backbone: pGEX4T2
• Backbone manufacturer: GE Healthcare Life Sciences
• Backbone size w/o insert (bp): 4970
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RANKL (receptor activator of nuclear factor kappa-B ligand)
• Species: M. musculus (mouse)
• Insert Size (bp): 480
• Mutation: aa158-aa316
• GenBank ID: NM_011613.3
• Entrez Gene: Tnfsf11 (a.k.a. Ly109l, ODF, OPGL, RANKL, Trance)
• Promoter: Ptac (trp/lac)
• Tag / Fusion Protein:
  • GST (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GCAAGCTACCTGAAATGCTG
• 3′ sequencing primer: ATACACTCCGCTATCGCTAC

Resource Information

• Supplemental Documents:
  • pGEX4T2 RANK-L Clone 1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry