CAG-mCherry
(Plasmid #108685)

• Purpose: Strong CAG promoter with mCherry expression for transfection efficacy screening
• Depositing Lab: Jordan Green
• Publication: Mishra et al Regen Eng Transl Med. 2019 Sep;6(3):273-285. doi: 10.1007/s40883-019-00118-1. Epub 2019 Jul 24.

Backbone

• Vector backbone: ColE1
• Backbone size w/o insert (bp): 4888
• Total vector size (bp): 5599
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 795
• Promoter: CAG

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: TACAGCTCCTGGGCAACGTG
• 3′ sequencing primer: CCC ATA TGT CCT TCC GAG TG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Karl Wahlin
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/02/13/264390 for bioRxiv preprint.