pGEXNKI-GST-3C-LIC
(Plasmid
#108710)
-
Purpose(Empty Backbone) Expression of a GST-tagged target protein with 3C protease cleavage site.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX
-
Backbone manufacturerNovagen
- Backbone size (bp) 5128
-
Vector typeBacterial Expression
- Promoter tac
-
Tag
/ Fusion Protein
- GST-3C protease cleavage site (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCAAGTATATAGCATGGCCTTTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEXNKI-GST-3C-LIC was a gift from Titia Sixma (Addgene plasmid # 108710 ; http://n2t.net/addgene:108710 ; RRID:Addgene_108710) -
For your References section:
Enabling high-throughput ligation-independent cloning and protein expression for the family of ubiquitin specific proteases. Luna-Vargas MP, Christodoulou E, Alfieri A, van Dijk WJ, Stadnik M, Hibbert RG, Sahtoe DD, Clerici M, Marco VD, Littler D, Celie PH, Sixma TK, Perrakis A. J Struct Biol. 2011 Aug;175(2):113-9. doi: 10.1016/j.jsb.2011.03.017. Epub 2011 Mar 29. 10.1016/j.jsb.2011.03.017 PubMed 21453775